Lecture #6. From Chromosomal DNA to Genetic Recombination.

In addition to centromeres, as we mentioned in the last lecture, when discussing YACs, The linear nature of the eukaryotic chromosome brings with it some inherent problems, namely that after each round of replication each chromosome (of necessity, must be shorter.  Consequently, each eukaryotic chromosome has t ohave a buffer region its extremities......called the telomere.   Another quite important function of the telomere is to distinguishthe end of a chromosome from any other 3' or 5' end of DNA, as the ends of DNA as we shall see play pivotal roles in recombination-rpeair mechanisms of DNA.

All telomeric sequences can be written in the general form Cn(A/T)m, where n >1 and m is 1- 4

Certain proteins bind to the telomere to protect it from degradation (as in the formation of the G-tail).  If degradation does occure, the problem can be solved in some cells by the action of the telomerase.

The telomerase is a large ribonucleoprotein that consists of a templating RNA (coded by TLC1) and a protein with catalytic activity (EST2 in Yeast). The short RNA component (exampliofied in the literature by the 159 bases long RN Acomponent in Tetrahymena,) includes a sequence of 15-22 bases that is identical to two repeats of the C-rich repeating sequence. This RNA provides the template for synthesizing the G-rich repeating sequence. The protein component of the telomerase can act only upon the RNA template that the nucleic acid component provides (for review see Blackburn, 1991; Blackburn, 1992 and Collins, 1999).  The telomerase itself does not appear to control the length of the telomere.  That role falls to additional telomerase/telomere binding proteins that control the availabilty of the telomere to the substrate.

             

The function of telomerase is to compensate for the shortening of telomeres that occurs at each replication cycle. Telomerase is turned off in many somatic cells, typically when differentiation occurs.  When this occurs the cells become unable to propagate as the stability of the ends of the chromosomes decreases, and the cells become senescent. 

 

When cells enter senescence the loss of the telomere-binding protein activates the production of p53, which leads to aself debilitating cascade of growth arrest and/or apoptosis (Karlseder et al., 1999; Li et al., 2003).

But, getting back to themore general features of the chromosome.

Often there are additional, distinctive, physical feature on some of the chromosomes such as nucleolar organizers: These are secondary constrictions of chromosomes (ranging from one to a few per chromosome) which apparently attach to (or organize) a nuclear organelle... the nucleolus, which contains rRNA. Sequence investigation of these nucleolar organizers have determined that they are composed of a number of repetitive DNA elements which turn out to be tandem repeats of rRNA genes

The additional aspect that we discussed towards the end of the last lecture and does demonstrate a major difference between the prokaryotic and eukaryotic chromosmes is the aspect of genome size and "complexity".....

As we discussed, the length of the DNA (or the size of the genome) can be roughly be associated with the complexity of the organisms.......i.e. higher eukaryotes have correspondingly more "complex genomes and (as a result) more DNA.
     

However, much to our chagrin, humans do not have the largest genome or C-value. Being quite an egotistical species we feel highly uncomfortable with this state of affairs, and thus devised an argument as to why there are exceptions to the generality. We also coined a term for these exceptions; the C-value paradox!! It is not really a paradox, as we shall see, but it does suggest that the larger the size of a concern...the more complex the genetic concerns, and (as ever) the more highly subjective and erroneous the perspective.

Three Distinct classes of DNA in Eukaryotes:

Highly repetitive Complexity ~300bp in length, ~1,000,000 copies per genome.

Moderately repetitive DNA, Complexity ~600,000bp ~400 copies per cell, e.g.. rRNA, Ribosomal Proteins and Histones.

Unique DNA sequences having a complexity ~300,000,000 or 3.0x10[8] bp.

Can include unique structural genes, but also other "unique" sequences.

How do we know all this, i.e. how do we characterize complexity?

............Tm profiles of DNA re-hybridizations

Mostly the genomes of eukaryotes are interspersions of moderately repetitive and unique sequences, but different chromosomes that encode some of the highly repetitive and some of the moderately repetitive DNA sequences have resulted from the presence of viral or transposon-like elements within the genome, e.g.. AluI sequences which are ~300 bo sequence repeats found in moderately repetetive DNA sequences in humans and other mammals.  These sequences are systematically cleaved at ~170bp by the Alu I restriction enzyme.  These Alu I sequences bear a strng homology to the 7SL RNA, a component of the signal recognition particle in export of newly translated peptides.

Transposed sequences, viral insertions and retroposons.

 

Dispersed Gene families of DNA such as the histones 100 - 1,000 copies per genome, actins, 5 -30 etc.

  

Satellite DNA: Surrounds centromeres and can be u to hundreds of kilobases in length, comprised of simple repetitious DNA. eg. 5’AATAACATAGAATAACATAGAATAACATAG3’ surrounds all centromeres in Drosophila melanogaster.

VNTR’s Variable number of tandem repeats of 15 -100 nucleotides in length that can extend from 1 -5 kbp in humans.

Such significant stretches of DNA redundancy creates its own problems....because it potentiates the formation of insertions and deletions (see later on in lecture series). These hypervariable regions can also be utilized to specific advantage...as it allows for PCR identification of specific DNA sequences eg. DNA fingerprinting.

Additional DNA also exists........ coined  "Spacer DNA", which euphemistically can be seen as.... what ever is left.
Not only are there different levels of "complex" DNA regions within the eukaryotic chromosome, the "architecture" of the DNA differs. Eukaryotic chromosomes are made up of chromatin. Heterochromatin and euchromatin.
A fourth difference between the chromosomes of eukaryotes and prokaryotes........DNA packaging.

Karyotyping of metaphase chromosomes is often undertaken using a variety of stains, which differentially stains the chromosomes, eg. G-staining, which can be used to stain chromosomes, gives tell-tale "Striping" of different chromosomes. G-dark and G-light staining regions, which reflect both AT and GC content, but more so "accessibility" or "openness" of DNA... The more darkly stained being the more active!!! Other stains, Feulgen, for example, stains heterochromatin more.eg. being Feusin; another, quinacrine giving Q bands. The characteristic chromomere banding allows you to pair up individual chromosomes.

             

In some cells eg. salivary glands of D. melanogaster giant chromosomes there are giant or polytene chromosomes due to apheomeon calle endomitosis.

Q-banding (quinicrine) is a dye that can also be used to show distinct bands which have been shown to correspond to active regions of the chromosome. Occasionally "puffs" are seen within these bands which are thought to and have been shown to be due to replicative and or transcriptional activity.

 

Differences are a function of compaction of DNA, which can be easily seen to occur during meiosis.

But what allows for this variable degree of compaction, what controls it and what determines it!

Facultative chromatin, can be turned off or on. eg. Barr, bodies, in Mealy bugs, where a whole set of haploid chromosomes can be turned off and be seen to be inactivated because they appear like metaphase chromosomes in interphase.

Also the the "random" turning off of one of the X chromosomes in mammalian females --> tortoise shell and calico cats, and secretor cells in humans(?), that are all heterozygote for the pertinent X-linked genes.   Inactivation of one or the other X- chromosome, again resulting from a condensation of the chromosome essentially can therefore give ries to significantly decreased expression of gene from that particular chromosome.

As to what allows for this to occur......

The protein "content" of eukaryotic chromosome is predominantly made up of "Histones". These protein(s) are DNA binding proteins that bind "non-specifically", but very uniformly, allowing the DNA to be wrapped around their forms in units of ~200 bps.

 

          

Five types H1, H2A, H2B, H3 & H4. H1 is Lysine rich. The assembly of histones form an octameric core called the nucleosome, which is made up of H2 through H4 protein complexes (two of each), which allows for precisely 146 bp of DNA to wrap around its surface (a number, which is curiously one of the few constant throughout the eukaryotic world). H1 then binds to the remaining DNA, ~54 bp, allowing some degree of flexibility between each of the coils, which promotes another order of packaging of these coils into the ordered aggregates called solenoids. These solenoids average ~30 nm in diameter. Strings of solenoids further condense by looping DNA into and out of a highly dense region of protein, termed scaffold regions, which can (in turn) promote additional varying degrees of compaction. This scaffold is predominantly made up of a protein (enzyme), topoisomerase, which attaches to specific sequences of the DNA called scaffold attachment regions (SAR’s).

Intuitively, the more dense the packing of DNA, the less the DNA is available to be either replicated or transcribed. Thus, even at the level of the solenoid formation, the DNA must be accessible. Consequently it is currently believed that the nucleosome has at least two configurations which respectively disallow and allow replication or transcriptional activity to occur within its confines. Spacing or "phasing" of nucleosomes is an important aspect of chromosomal structure, can be defined intrinsically and extrinsically. Degree of heterochromatin vs. euchromatin is determined by additional protien DNA interactions.

Chapter 20 in genes VIII and ergito.com.

While such packing of the DNA may solve the size problems...there are inherent problems with such packaging of DNA.

1. Access to the DNA of critical proteins!
2. If the packaging of the various DNA sequences is random, access will be random!!

If there is control of nucleosomal packaging, what controls the boundaries of heterochromatin or euchromatin....?

There is no really clear cut, definitive answer to this fundamental question. There are some indications, however, and some types of mutations are known to occur as a result of variable extensions of heterochromatin extending into euchromatin regions of the chromosome, termed: position effect gene inactivation. Such extensions of heterochromatin can be suppressed by various factors, whose effect on the system is dosage dependent. More recent advances in research undertaken upon histonal coverage of chromosomes tend to suggest that specific enzyme-dependent (hormonally controlled) chemical modification of histones (acetylation/deacetylation) gives rise to a variability in the affinity that different histones may have for the DNA that is wrapped around their surfaces. Even so, the idea of nucleosomal phasing is understood.

Question: Are nucleosomes deposited on the DNA in a purely random way?

Option (a) YES!

Alternatives.

(b)They are located by site specific interaction between specific DNA sequences and nucleosome proteins

(c) The location of certain histones is fixed by a boundary (e.g. a promoter) at the 5' end of the gene and subsequent nucleosomes are spaced out evenly from that point

If you consider two points, (i) the boundary of DNA bound to the nucleosome, i.e. where it emerges into linking DNA, and (ii) a restriction enzyme cleavage site, then : if the nucleosomes assort freeely on the DNA the distance from (i) to (ii) will be random.

Alternative (b) would suggest that the distance will always be fixed.

Alternative (c) would suggest that the distance would be relatively constant in nucleosomes that are close to the "defined boundary", but the "phasing" of the bound nucleosomes will decrease with increasing distance from the boundary.

Point (i) can become defined by complete digestion with an enzyme called micrococcal nuclease, which would trim all linkers back to the nucleosome.

Point (ii) can be defined by use of a unique R.E. cleavage sites that are either proximal or distal to the "potential" boundary.

               

Electrophoresis of the digested band will give a total smear if the nucleosomal organization is totally random, a tight bands if the binding is specific and a more diffuse band pattern from option (c).

     

 

How is phasing broaught about?

Effect of replication and transcription on phasing.....

              

Centromeres are all heterochromatic, as are telomeres, termed "constitutive heterochromatin" because it is essentially "inert", except with respect to its ability to bind spindle fibres (as far as the centromeres are concerned).

Mechanisms of Genetic Exchange

Mutations: What they are, and how varied they can occur.

Essentially mutations are "changes in genetic sequence or structure that give rise to a genotypic or phenotypic change" (Not all genotypic changes gives rise to a phenotypic change!!).

Quick r eview of the genetic code
General rules that define the Genetic code:

(a) Universal? (generally true, but organellar and other variations. However, codons always read in threes.
(b) All "reading frames" are initiated from a fixed start
(c) "Reading frames" are non-overlapping, Essentially true most of the time, but not required.
(d) Code is Degenerate. Variety within each of the codon bases,

3 classes: Non degenerate, 2-fold degenerate and 4-fold degenerate codons.

Additional use of Inosine in the anticodon of tRNA allows for any given tRNA to interact potentially with three codons and still encode for the same amino acid

Molecular bases for mutation, Transitions, Transversions, Point Mutations, Possible frameshift, (insertion, deletions give rise to nonsense and missense mutations), compensatory mutations (probably initially via "suppression"). Mutations will and do arise naturally.  However, they can also occur with a little help from mutagens.

Transitions or transversions.  Which ine is more likely?

Mutagenesis

Each base can exist in a variety of different chemical forms called tautomers. While Watson-Crick base pairing is the norm, tautomeric shifts can occur, where the electrons are shifted around the various base molecular structure to allow for a variation in base pairing.

         

Tautomeric shifts invariably give rise to transitions.
5 -bromouracil -> prefers the 'enol tautomer', and if incorporated into the double helix will therefore more than likely give rise t
o a C:G base pairing where a T:A once was.

 

Alkylating agents such as EMS (Ethyl Methane Sulphonate) alkylate either guanines or thymines

G:C -> A:T
        or
T:A -> C:G

Nitrous acid, which oxidatively deaminates cytosine ---> uracil

thus: C:G -> U:A ---> T:A in the next round of replication.

 

Such oxidation of cytosine, however, is a common, natural occurrence and the most commonly "acceptable" genetic change. Why should this be?

Hydroxylamine G:C ---> A:T transitions

      

Intercalating agents:

e.g.. Acridine orange: intercalates between the stacked DNA bases and introduces an extra base length into the double helix; which in turn will introduces an extra base in to the next replicative form. What are the results.....

 

UV -radiation causes thymine:thymine dimers...... requires an excision repair mechanism, which involves DNA Pol I in prokaryotes (in combination with a UvrABC repair system).

Insertions and Deletions: Spontaneously occurring mutations, which account for 12% of the known mutations. Duplications (which can occur with a variable frequency, depending upon the genetic neighbourhood).

This is really the only way that a bacterial cell can increase the concentration of any particular DNA sequence.

Intercalating agents can and do enhance this activity.

Large scale chromosomal variations, Inversions, translocations (insertions) see later in text.

Transposition: Method of transposition or translocation, often leaves small inserts of DNA from 3-17 bases, which change the resulting protein sequence, either by causing a frameshift or just by in-frame insertion of an amino acid or two.

Genes VII chapter 14 (recombination and repair) and pages 462-473 for transposition.

Cellular responses to these genetic insults:

Most mutations can be corrected before they do damage, by catching the mutational event before it becomes incorporated into the next generation.

Direct reversal of damage by specific enzymes. e.g.. alkyl transferases.

Replicational: Remember that inherent Processivity of DNA polymerase requires that 3'OH be in the appropriate position. If not, the polymerase is able to reverse itself (3'->5' repair mechanism) and replace aberrantly inserted base(s) through this proof-reading mechanism.

DNA Glycosylases:  There are numerous types of DNA glycosylases, but the process for each are very similar.  Damaged bases and other "non-uniform" deoxy ribonucleotide sequences and bases (such as uracil) are removed.

MYTY: MutM, MutY, MutT and MutY systems repair mismatches as a result of

8-hydroxyguanine GO:A mismatch G:C ---> GO:A or T:A (is this a transition or a transversion??),

Both these systems occur pre- and post- replication, giving very different results in the case of MYTY system.

Postreplicational mismatch repair mechanisms.

UV repair: of UV induced T-T dimers..... requires an excision repair mechanism, which involves DNA Pol I in prokaryotes (in combination with a uvrABC repair system).


MutLUSH: In prokaryotes, the MutL, MutU, MutS and MutH system. Specificity of strand repair is defined by methylation of the adenine in 5'GATC3' sequence.


Let us also review some of the more generic players involved in DNA repair and replication

DNA polymerase (I or III)
Restriction / modification enzymes
Ligases
Topoisomerases
Glycosylases.
Nickases

But what of the larger molecular rearrangements that involve genetic recombination.

Remember chiasma and chiasmata. What are these structures at the molecular level, and how are they resolved?

Holliday junctions

        

Integration of DNA through such a mechanism necessitates the availability of regions of DNA homology, often provided by IS elements.

But where did these IS elements come from, and how are they related to their close cousins, the transposons?

IS elements aproximate 700 - 2,500 bp in length.They can reside in bacteria, phage, plasmids and are also found -in abundance- in eukaryotes such as maize.  They einvariablt encode for inverted or non-inverted repeats at their termini.

Transposons -a little larger- approximate 2,500 - 7,000bp, and are again found in a wide assortment of "hosts" and encode gene(s) that potentiate their movement, transposases. Also (in bacteria at least) these trasnposons more often than not impart a selective advantage to the host -ranging from antibiotic resistance genes to those that provide resistance to heavy metals.

Transposition of IS elements or transposons: Method of transposition or "translocation", often leaves small inserts of DNA from 3 - 17 bases, which change the resulting protein sequence, usually by causing a frameshift in the targeted DNA.

In essence, the ability to transpose seems to be ancestral, and has subsequently been modified as organisms diverge.

Some of the consequences of transposition.

1.    5-15% of spontaneous bacterial mutations are caused by transposons.
2.    The insertion of a transposon in the middle of a gene can completely eliminate gene function.
3.   The insertion of transposons causes a small duplication of sequences at the site. Due to changes during excision, quite often the resulting DNA will still exhibit mutant  phenotype, even without transposon present

Conservative (non-replicative) vs. Replicative transposition.

in prokaryotes, transposition normally comes in "two flavours": conservative and replicative.  While the outcome between the two is similar, their mechanisms of transposition are quite distinct.

   

Tn10 (Bender and Kleckner, 1986) vs. Tn3 (Heffron, 1983).
Transpositional "scars" provide some of the clues as to the precise mechanism of transpositional insertion.

  •  

    This information is given as a guide to the student attending the Bio4564 lectures as a means to review some of the information. It is not meant to replace the lecture. No emphasis as to what will be required of the student is given in this text, indeed information that is given in the these transcripts may make little sense if the student has not first attended the relevant lecture. 

  •