Lecture #6. From Chromosomal DNA to Genetic Recombination.

In addition to centromeres, as we mentioned in the last lecture, when discussing YACs, The linear nature of the eukaryotic chromosome brings with it some inherent problems, namely that after each round of replication each chromosome (of necessity, must be shorter.  Consequently, each eukaryotic chromosome has t ohave a buffer region its extremities......called the telomere.   Another quite important function of the telomere is to distinguishthe end of a chromosome from any other 3' or 5' end of DNA, as the ends of DNA as we shall see play pivotal roles in recombination-rpeair mechanisms of DNA.

All telomeric sequences can be written in the general form Cn(A/T)m, where n >1 and m is 1- 4

Certain proteins bind to the telomere to protect it from degradation (as in the formation of the G-tail).  If degradation does occure, the problem can be solved in some cells by the action of the telomerase.

The telomerase is a large ribonucleoprotein that consists of a templating RNA (coded by TLC1) and a protein with catalytic activity (EST2 in Yeast). The short RNA component (exampliofied in the literature by the 159 bases long RN Acomponent in Tetrahymena,) includes a sequence of 15-22 bases that is identical to two repeats of the C-rich repeating sequence. This RNA provides the template for synthesizing the G-rich repeating sequence. The protein component of the telomerase can act only upon the RNA template that the nucleic acid component provides (for review see Blackburn, 1991; Blackburn, 1992 and Collins, 1999).  The telomerase itself does not appear to control the length of the telomere.  That role falls to additional telomerase/telomere binding proteins that control the availabilty of the telomere to the substrate.

The function of telomerase is to compensate for the shortening of telomeres that occurs at each replication cycle. Telomerase is turned off in many somatic cells, typically when differentiation occurs.  When this occurs the cells become unable to propagate as the stability of the ends of the chromosomes decreases, and the cells become senescent. 

When cells enter senescence the loss of the telomere-binding protein activates the production of p53, which leads to aself debilitating cascade of growth arrest and/or apoptosis (Karlseder et al., 1999; Li et al., 2003).

The additional aspect that we discussed towards the end of the last lecture and does demonstrate a major difference between the prokaryotic and eukaryotic chromosmes is the aspect of genome size and "complexity".....

However, much to our chagrin, humans do not have the largest genome or C-value. Being quite an egotistical species we feel highly uncomfortable with this state of affairs, and thus devised an argument as to why there are exceptions to the generality. We also coined a term for these exceptions; the C-value paradox!! It is not really a paradox, as we shall see, but it does suggest that the larger the size of a concern...the more complex the genetic concerns, and (as ever) the more highly subjective and erroneous the perspective.

Three Distinct classes of DNA in Eukaryotes:

Moderately repetitive DNA, Complexity ~600,000bp ~400 copies per cell, e.g.. rRNA, Ribosomal Proteins and Histones.

Unique DNA sequences having a complexity ~300,000,000 or 3.0x10[8] bp.

Can include unique structural genes, but also other "unique" sequences.

............Tm profiles of DNA re-hybridizations

Mostly the genomes of eukaryotes are interspersions of moderately repetitive and unique sequences, but different chromosomes that encode some of the highly repetitive and some of the moderately repetitive DNA sequences have resulted from the presence of viral or transposon-like elements within the genome, e.g.. AluI sequences which are ~300 bo sequence repeats found in moderately repetetive DNA sequences in humans and other mammals.  These sequences are systematically cleaved at ~170bp by the Alu I restriction enzyme.  These Alu I sequences bear a strng homology to the 7SL RNA, a component of the signal recognition particle in export of newly translated peptides.

Dispersed Gene families of DNA such as the histones 100 - 1,000 copies per genome, actins, 5 -30 etc.

Satellite DNA: Surrounds centromeres and can be u to hundreds of kilobases in length, comprised of simple repetitious DNA. eg. ^5’AATAACATAGAATAACATAGAATAACATAG^3’ surrounds all centromeres in Drosophila melanogaster.

VNTR’s Variable number of tandem repeats of 15 -100 nucleotides in length that can extend from 1 -5 kbp in humans.

Such significant stretches of DNA redundancy creates its own problems....because it potentiates the formation of insertions and deletions (see later on in lecture series). These hypervariable regions can also be utilized to specific advantage...as it allows for PCR identification of specific DNA sequences eg. DNA fingerprinting.

Karyotyping of metaphase chromosomes is often undertaken using a variety of stains, which differentially stains the chromosomes, eg. G-staining, which can be used to stain chromosomes, gives tell-tale "Striping" of different chromosomes. G-dark and G-light staining regions, which reflect both AT and GC content, but more so "accessibility" or "openness" of DNA... The more darkly stained being the more active!!! Other stains, Feulgen, for example, stains heterochromatin more.eg. being Feusin; another, quinacrine giving Q bands. The characteristic chromomere banding allows you to pair up individual chromosomes.

In some cells eg. salivary glands of D. melanogaster giant chromosomes there are giant or polytene chromosomes due to apheomeon calle endomitosis.

Q-banding (quinicrine) is a dye that can also be used to show distinct bands which have been shown to correspond to active regions of the chromosome. Occasionally "puffs" are seen within these bands which are thought to and have been shown to be due to replicative and or transcriptional activity.

Differences are a function of compaction of DNA, which can be easily seen to occur during meiosis.

But what allows for this variable degree of compaction, what controls it and what determines it!

Facultative chromatin, can be turned off or on. eg. Barr, bodies, in Mealy bugs, where a whole set of haploid chromosomes can be turned off and be seen to be inactivated because they appear like metaphase chromosomes in interphase.

Also the the "random" turning off of one of the X chromosomes in mammalian females --> tortoise shell and calico cats, and secretor cells in humans(?), that are all heterozygote for the pertinent X-linked genes.   Inactivation of one or the other X- chromosome, again resulting from a condensation of the chromosome essentially can therefore give ries to significantly decreased expression of gene from that particular chromosome.

The protein "content" of eukaryotic chromosome is predominantly made up of "Histones". These protein(s) are DNA binding proteins that bind "non-specifically", but very uniformly, allowing the DNA to be wrapped around their forms in units of ~200 bps.

Five types H1, H2A, H2B, H3 & H4. H1 is Lysine rich. The assembly of histones form an octameric core called the nucleosome, which is made up of H2 through H4 protein complexes (two of each), which allows for precisely 146 bp of DNA to wrap around its surface (a number, which is curiously one of the few constant throughout the eukaryotic world). H1 then binds to the remaining DNA, ~54 bp, allowing some degree of flexibility between each of the coils, which promotes another order of packaging of these coils into the ordered aggregates called solenoids. These solenoids average ~30 nm in diameter. Strings of solenoids further condense by looping DNA into and out of a highly dense region of protein, termed scaffold regions, which can (in turn) promote additional varying degrees of compaction. This scaffold is predominantly made up of a protein (enzyme), topoisomerase, which attaches to specific sequences of the DNA called scaffold attachment regions (SAR’s).

Intuitively, the more dense the packing of DNA, the less the DNA is available to be either replicated or transcribed. Thus, even at the level of the solenoid formation, the DNA must be accessible. Consequently it is currently believed that the nucleosome has at least two configurations which respectively disallow and allow replication or transcriptional activity to occur within its confines. Spacing or "phasing" of nucleosomes is an important aspect of chromosomal structure, can be defined intrinsically and extrinsically. Degree of heterochromatin vs. euchromatin is determined by additional protien DNA interactions.

Chapter 20 in genes VIII and ergito.com.

While such packing of the DNA may solve the size problems...there are inherent problems with such packaging of DNA.

If there is control of nucleosomal packaging, what controls the boundaries of heterochromatin or euchromatin....?

There is no really clear cut, definitive answer to this fundamental question. There are some indications, however, and some types of mutations are known to occur as a result of variable extensions of heterochromatin extending into euchromatin regions of the chromosome, termed: position effect gene inactivation. Such extensions of heterochromatin can be suppressed by various factors, whose effect on the system is dosage dependent. More recent advances in research undertaken upon histonal coverage of chromosomes tend to suggest that specific enzyme-dependent (hormonally controlled) chemical modification of histones (acetylation/deacetylation) gives rise to a variability in the affinity that different histones may have for the DNA that is wrapped around their surfaces. Even so, the idea of nucleosomal phasing is understood.

Question: Are nucleosomes deposited on the DNA in a purely random way?

Option (a) YES!

(b)They are located by site specific interaction between specific DNA sequences and nucleosome proteins

(c) The location of certain histones is fixed by a boundary (e.g. a promoter) at the 5' end of the gene and subsequent nucleosomes are spaced out evenly from that point

If you consider two points, (i) the boundary of DNA bound to the nucleosome, i.e. where it emerges into linking DNA, and (ii) a restriction enzyme cleavage site, then : if the nucleosomes assort freeely on the DNA the distance from (i) to (ii) will be random.

Alternative (c) would suggest that the distance would be relatively constant in nucleosomes that are close to the "defined boundary", but the "phasing" of the bound nucleosomes will decrease with increasing distance from the boundary.

Point (i) can become defined by complete digestion with an enzyme called micrococcal nuclease, which would trim all linkers back to the nucleosome.

Point (ii) can be defined by use of a unique R.E. cleavage sites that are either proximal or distal to the "potential" boundary.

Electrophoresis of the digested band will give a total smear if the nucleosomal organization is totally random, a tight bands if the binding is specific and a more diffuse band pattern from option (c).

How is phasing broaught about?

Effect of replication and transcription on phasing.....

Centromeres are all heterochromatic, as are telomeres, termed "constitutive heterochromatin" because it is essentially "inert", except with respect to its ability to bind spindle fibres (as far as the centromeres are concerned).